The CBSE Class 12 Biology Sample Paper 2026 is a valuable resource for students preparing for the upcoming board examinations. Designed as per the latest CBSE syllabus and exam pattern, it helps students understand the structure of the question paper, marking scheme, and types of questions expected in the exam. Practicing sample papers strengthens conceptual clarity in key topics such as Genetics, Biotechnology, Ecology, and Human Health. It also improves time management, answer-writing skills, and confidence before the final exam. Regular practice with sample papers enables students to identify weak areas and enhance overall exam readiness.
Sample papers are useful study material for students to check their understanding of subjects, know the final exam structure, highlight important exam topics, and become acquainted with probable question styles. Students can readily access and download the CBSE Class 12th biology Sample paper 2026 PDF with solutions from here, which is an excellent resource for self-assessment and revision.
The CBSE Class 12 Biology Sample Paper 2025-26 PDF is an official practice question paper released by the Central Board of Secondary Education for the academic session 2025-26. It is available for free download on the CBSE Academic website and follows the latest exam pattern with 33 compulsory questions divided into five sections (Objective, Short-answer, Long-answer, Case-based) for 70 marks in 3 hours. The sample paper helps students understand the question types, marking scheme and exam structure to improve preparation and time management before the board exam.
| CBSE Class 12th Biology Sample Paper PDF download | |
| CBSE Class 12 Biology Sample Paper 2025-26 PDF Download | Biology-Paper-SQP |
| CBSE Class 12th Biology Sample Paper Solutions | Biology-Paper-MS |
The CBSE Class 12 Biology Sample Paper Pattern is presented clearly in tabular form, as per the latest CBSE exam structure (Theory – 70 Marks):
| Section | Type of Questions | No. of Questions | Marks per Question | Total Marks |
|---|---|---|---|---|
| A | Multiple Choice Questions (MCQs) | 16 | 1 | 16 |
| B | Very Short Answer Questions | 5 | 2 | 10 |
| C | Short Answer Questions | 7 | 3 | 21 |
| D | Long Answer Questions | 2 | 5 | 10 |
| E | Case-Based / Assertion-Reason Questions | 3 | 4 | 12 |
| Total | — | 33 Questions | — | 70 Marks |
All questions are compulsory
Internal choices are provided in Sections B, C, D, and E
Section E questions are based on case studies, diagrams, or real-life situations
The paper is designed to test conceptual understanding, application, and analytical skills
1 The male gametes are formed by:
A. Mitotic division of the nucleus of the vegetative cell
B. Meiotic division of the nucleus of the vegetative cell
C. Mitotic division of the nucleus of the generative cell
D. Meiotic division of the nucleus of the generative cell
2 The primary endosperm nucleus is formed by the fusion of which of the
following?
A. A male gamete and a female gamete
B. A male gamete and two polar nuclei
C. A female gamete and two synergids
D. Two male gametes and an egg cell
3 During the menstrual cycle of a human female, formation of the Graafian follicle is stimulated by the secretion of which of the following gonadotropin hormones?
A. Estrogen and progesterone
B. FSH and Estrogen
C. FSH and LH
D. Progesterone and LH
4. The experimental proof on the thermal stability of genetic material was first provided by experiments of
A. Hershey and Chase
B. Meselson and Stahl
C. Frederick Griffith
D. Jacob and Monod
5. Short stretches of DNA are used to identify complementary sequences in a
Samples are called
A. Probes
B. Markers
C. Primers
D. Minisatellites
6 Select the incorrect statement among the following.
A. p²+2pq+q² = 1. This is the binomial expansion of (p+q)²
B. When the frequency measured differs from the expected values, the difference (direction) indicates the extent of evolutionary change.
C. Hardy-Weinberg principle says that phenotype frequencies in a population are stable and are constant from generation to generation.
D. The gene pool (total genes and their alleles in a population) remains constant. This is called genetic equilibrium. The total of all the allelic frequencies is 1.
7. Albinism is known to be due to an autosomal recessive mutation. The first child of a couple with normal skin pigmentation was an albino. What is the probability that their second child will also be an albino?
A. 100%
B. 25%
C. 50%
D. 75%
8 “In Cricket species, the sound produced by rubbing the wings or legs together plays a crucial role in attracting mates; any change in the morphology of Cricket legs could potentially affect their ability to produce sound”.
A mutant Cricket had thicker hind legs. What would you expect for this cricket species?
A. The leg mutation will not lead to speciation if they diversify into new habitats.
B. The leg mutation will have little effect on other external features, and therefore have little effect on speciation.
C. The leg mutation will not affect behavior, and thus has little effect on speciation.
D. The leg mutation might lead to reproductive isolation and speciation due to an effect on the mating call.
9. Plasmodium is a pathogen that causes malaria. Identify the correct sequence of transmission of the pathogen.
10. Which mRNA will be translated to a polypeptide chain containing 8 amino acids?
A. AUGUUAAUAGACGAGUAGCGACGAUGU
B. AUGAGACGGACUGCAUUCCCAACCUGA
C. AUGCCCAACCGUUAUUCAUGCUAG
D. AUGUCGACAGUCUAAAACAGCGGG
11 To isolate the genetic material of a bacterium, the cell must be treated
with
A. Lysozyme, ribonuclease, protease, chilled ethanol
B. Cellulase, ribonuclease, protease, chilled ethanol
C. Chitinase, ribonuclease, chilled ethanol, water
D. Ribonuclease, protease, chilled ethanol, water
12 Integrated Pest Management involves
I. Using pesticides/insecticides judiciously
II. Using biocontrol agents
III. Engaging in organic farming
A. Only I
B. Only II
C. Both I and II
D. Only III
Questions No. 13 to 16 consist of two statements – Assertion (A) and Reason (R). Answer these questions by selecting the appropriate option given below:
A. Both A and R are true, and R is the correct explanation of A.
B. Both A and R are true, and R is not the correct explanation of A.
C. A is tr, but R is false.
D. A is Fa,lsut R is true.
13 Assertion (A): The ability of the pistil to recognise the pollen is the result of a continuous dialogue between pollen and pistil.
Reason (R): This electrical dialogue allows only compatible pollen to germinate.
14 Assertion (A): Some organisms are better adapted to survive in an otherwise hostile environment.
Reason (R): Adaptive ability is inherited and has a genetic basis.
15 Assertion (A): Excess dose of coke or crack produces a sense of
euphoria, increased energy, and causes hallucinations.
Reason(R): It interferes with the transport of dopamine
16 Assertion (A): Rosie was the first transgenic cow to make more nutritionally balanced milk for consumption by human babies.
Reason (R): The milk of Rosie’s cow contained human beta-lactalbumin, which made the milk rich in protein.
Solving the CBSE Class 12 Biology Sample Paper 2025–26 offers several important advantages for students. It helps them understand the latest exam pattern, marking scheme, and the types of questions likely to be asked in the board examination. Regular practice with sample papers improves time management and boosts speed and accuracy while attempting the actual paper. It also allows students to identify weak topics, revise important concepts, and strengthen answer-writing skills, especially for diagrams and long-answer questions. Overall, solving sample papers builds confidence, reduces exam stress, and ensures better preparedness for scoring high marks in Biology.
The sample paper has five sections with a total of 33 compulsory questions covering different marks:
Section A – 16 × 1-mark questions
Section B – 5 × 2-marks
Section C – 7 × 3-marks
Section D – 2 × 4-marks (case-based)
Section E – 3 × 5-marks
Total Marks = 70 (theory) and time = 3 hours.
Yes — all 33 questions are compulsory. Some questions include internal choices (where you choose one option among alternatives).
You will get:
Multiple Choice Questions (MCQs)
Assertion-Reasoning or very short answers
Short answers
Long answers
Case-based questions that test application of concepts.
Yes — the sample paper is prepared strictly as per the updated CBSE syllabus and exam pattern for 2025-26.
Sample papers help you:
Understand the exam format & marking scheme
Practice time management (finish in 3 hours)
Get familiar with question types and expected answers
Improve answer writing skills and clarity.
Yes — solve it in three hours with no breaks to simulate the actual exam and improve exam confidence.
Yes — whenever necessary, neat and properly labeled diagrams should be drawn to score full marks.
Yes — the sample paper closely reflects the board exam pattern and types of questions you are likely to see in the actual CBSE Biology 2026 exam.
The official PDF is available on the CBSE Academic website (cbseacademic.nic.in) along with the marking scheme.
Yes — focus on:
Conceptual clarity over rote learning
Practicing previous year questions
Time management
Clear writing with key terms underlined
Regular revision of diagrams.
Top Schools in Oman: Oman, especially its capital, Muscat, has emerged as a strong education…
Jordan is widely recognized for having one of the strongest education systems in the Middle…
List of Countries Supporting Iran: The ongoing US–Israel vs Iran conflict (2026) has created a…
SITTTR Syllabus 2026-27: The State Institute of Technical Teachers’ Training & Research (SITTTR) plays a crucial…
The GNITS syllabus of G. Narayanamma Institute of Technology & Science (GNITS) for B.Tech programs…
The Punjab National Bank (PNB) Local Bank Officer (LBO) Exam 2026 is a great opportunity…